After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ECM1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ECM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_007899.2
RefSeq ORF Size:1680bp
cDNA Description:Full length Clone DNA of Mus musculus extracellular matrix protein 1 with N terminal His tag.
Gene Synonym:p85, AI663821, Ecm1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Extracellular matrix protein 1 (ECM1) is a secreted glycoprotein and playing a pivotal role in endochondral bone formation, angiogenesis, and tumour biology. Three splice variants have been identified: ECM1a (540 aa) is most widely expressed, with highest expression in the placenta and heart; ECM1b (415 aa) is differentiation-dependent expressed and found only in tonsil and associated with suprabasal keratinocytes; ECM1c (559 aa) accounts for approximately 15% of skin ECM1. Although ECM1 is not tumor specific, is significantly elevated in many malignant epithelial tumors and is suggested as a possible trigger for angiogenesis, tumor progression and malignancies. It also has been shown to regulate endochondral bone formation, skeletal development and tissue remodeling. 

References
  • Oyama N, et al. (2003) Autoantibodies to extracellular matrix protein 1 in lichen sclerosus. Lancet. 362(9378): 118-23.
  • Chan I, et al. (2004) Rapid diagnosis of lipoid proteinosis using an anti-extracellular matrix protein 1 (ECM1) antibody. J Dermatol Sci. 35(2): 151-3.
  • Lupo I, et al. (2005) A novel mutation of the extracellular matrix protein 1 gene (ECM1) in a patient with lipoid proteinosis (Urbach-Wiethe disease) from Sicily. Br J Dermatol. 153(5): 1019-22.
  • Sander CS, et al. (2006) Expression of extracellular matrix protein 1 (ECM1) in human skin is decreased by age and increased upon ultraviolet exposure. Br J Dermatol. 154(2): 218-24.
  • Size / Price
    Catalog: MG50331-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"