After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PLA2G1B ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PLA2G1B cDNA Clone Product Information
Gene_bank_ref_id:NM_011107.1
RefSeq ORF Size:441bp
cDNA Description:Full length Clone DNA of Mus musculus phospholipase A2, group IB, pancreas with N terminal His tag.
Gene Synonym:Pla2a, MGC6679, sPLA2IB, Pla2g1b
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Mouse phospholipase A2, also known as Phosphatidylcholine 2-acylhydrolase 1B, Group IB phospholipase A2, PLA2 and PLA2G1B, is a secreted protein which belongs to the phospholipase A2 family. Phospholipase A2 / PLA2G1B catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic Phospholipase A2 / PLA2G1B enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of Phospholipase A2 / PLA2G1B have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets. Mice lacking in Phospholipase A2 / PLA2G1B are resistant to obesity and diabetes induced by feeding a diabetogenic high-fat/high-carbohydrate diet. Oral supplementation of a diabetogenic diet with the PLA2G1B inhibitor methyl indoxam effectively suppresses diet-induced obesity and diabetes. PLA2G1B inhibition may be a potentially effective oral therapeutic option for treatment of obesity and diabetes.

References
  • Labonté,E.D. et al., 2006, Diabetes. 55 (4) :935-41.
  • Mounier,C.M. et al.,2008, Br J Cancer. 98 (3):587-95.
  • Hui,D.Y. et al., 2009, Br J Pharmacol. 157 (7):1263-9.
  • Labonté,E.D. et al., 2010, FASEB J. 24 (7):2516-24.
  • Size / Price
    Catalog: MG50329-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"