Quick Order

Text Size:AAA

Mouse KYNU / Kynureninase ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse KYNU cDNA Clone Product Information
Gene_bank_ref_id:NM_027552.1
RefSeq ORF Size:1398bp
cDNA Description:Full length Clone DNA of Mus musculus kynureninase (L-kynurenine hydrolase) with N terminal His tag.
Gene Synonym:4432411A05Rik, kynureninase
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Lima S, et al. (2007) Crystal structure of Homo sapiens kynureninase. Biochemistry. 46(10): 2735-44.
  • Momany C, et al. (2004) Three-dimensional structure of kynureninase from Pseudomonas fluorescens. Biochemistry. 43(5): 1193-203.
  • Toma S, et al. (1997) Cloning and recombinant expression of rat and human kynureninase. FEBS Lett. 408(1): 5-10.
  • Size / Price
    Catalog: MG50310-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"