After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse WTAP ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse WTAP cDNA Clone Product Information
Gene_bank_ref_id:NM_175394.2
RefSeq ORF Size:456bp
cDNA Description:Full length Clone DNA of Mus musculus Wilms tumour 1-associating protein with N terminal Myc tag.
Gene Synonym:2810408K05Rik, 9430038B09Rik
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

References
  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • Size / Price
    Catalog: MG52198-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"