Quick Order

Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAcDNA Clone Product Information
cDNA Size:1350
cDNA Description:ORF Clone of Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase DNA. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:Neuraminidase, NA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40045-ACG$325
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagVG40045-ACR$325
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40045-CF$295
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40045-CH$295
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40045-CM$295
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40045-CY$295
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40045-G$95
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40045-NF$295
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40045-NH$295
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40045-NM$295
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40045-NY$295
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40045-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items