After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PPIA ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PPIA cDNA Clone Product Information
Gene_bank_ref_id:NM_008907.1
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Mus musculus peptidylprolyl isomerase A with N terminal His tag.
Gene Synonym:Cphn, CypA, CyP-18, 2700098C05, Ppia
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Mouse peptidyl-prolyl cis-trans isomerase A, also known as PPIase A, Rotamase A, Cyclophilin A, Cyclosporin A-binding protein, PPIA and CYPA, is a cytoplasm protein which belongs to the cyclophilin-type PPIase family and PPIase A subfamily. Cyclophilins (CyPs) are a family of proteins found in organisms ranging from prokaryotes to humans. These molecules exhibit peptidyl-prolyl isomerase activity, suggesting that they influence the conformation of proteins in cells. PPIA / Cyclophilin A accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIA / Cyclophilin A is secreted by vascular smooth muscle cells in response to inflammatory stimuli, and could thus contribute to atherosclerosis. It is not essential for mammalian cell viability. PPIA / Cyclophilin A can interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions.

Size / Price
Catalog: MG50296-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"