After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CDH12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDH12cDNA Clone Product Information
cDNA Size:2385
cDNA Description:ORF Clone of Rattus norvegicus cadherin 12 DNA.
Gene Synonym:RGD1566350, Cdh12
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells when they are anchored to the actin cytoskeleton via their cytoplasmic binding partners, catenins. The cadherin/catenin adhesion system plays key roles in the morphogenesis and function of the vertebrate and invertebrate nervous systems. Furthermore, this system is involved in synaptic plasticity. Recent studies on the role of individual cadherin subtypes at synapses indicate that individual cadherin subtypes play their own unique role to regulate synaptic activities. Type II (atypical) cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. It has been observed that cells containing a specific cadherin subtype tend to cluster together to the exclusion of other types, both in cell culture and during development. Cadherin-12 also known as CDH12, is a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Cadherin-12 appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis.

  • Tanihara H, et al. (1994) Cloning of five human cadherins clarifies characteristic features of cadherin extracellular domain and provides further evidence for two structurally different types of cadherin. Cell Adhes Commun. 2(1): 15-26.
  • Suzuki SC, et al. (2008) Cadherins in neuronal morphogenesis and function. Dev Growth Differ. 50 Suppl 1: S119-30.