After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat MBL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MBL1cDNA Clone Product Information
cDNA Size:717
cDNA Description:ORF Clone of Rattus norvegicus mannose-binding lectin (protein A) 1 DNA.
Gene Synonym:Mbpa, Mlb1, Mbl1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Mannose-binding lectin (MBL), also named mannose or mannan-binding protein (MBP), is a C-type lectin which participates in the innate immune system as an activator of the complement system and as opsonin after binding to certain carbohydrate structures on microorganisms and pathogens. Its function appears to be pattern recognition in the first line of defense in the pre-immune host. MBL recognizes carbohydrate patterns found on the surface of a large number of pathogenic micro-organisms including bacteria, viruses, protozoa and fungi. Binding of MBL to a micro-organism results in activation of the lectin pathway of the complement system. Two forms of MBL, MBL-A and MBL-C, were characterized in rodents, rabbits, bovine and rhesus monkeys, whereas only one form was identified in humans, chimpanzees and chickens. The two forms are encoded by two distinct genes named MBL1 and MBL2, which have been identified in many species including the pig. The MBL1 and MBL2 genes encode mannan-binding lectins (MBL) A and C, respectively, that are collagenous lectins (collectins) produced mainly by the liver. The MBL1 gene encodes MBL-A, which has bacteria-binding properties in pigs and rodents but is mutated to a pseudogene in humans and chimpanzees. Deficiency of MBL is probably the most common human immunodeficiency and is associated with an increased risk of mucosally acquired infections including meningococcal disease. MBL could modify disease susceptibility by modulating macrophage interactions with mucosal organisms at the site of initial acquisition.

  • Jack DL, et al. (2005) Mannose-binding lectin enhances phagocytosis and killing of Neisseria meningitidis by human macrophages. J Leukoc Biol. 77(3): 328-36.
  • Lillie BN, et al. (2006) Single-nucleotide polymorphisms in porcine mannan-binding lectin A. Immunogenetics. 58(12): 983-93.
  • Nikolakopoulou K, et al. (2006) Molecular cloning and characterisation of two homologues of Mannose-Binding Lectin in rainbow trout. Fish Shellfish Immunol. 21(3): 305-14.
  • Phatsara C, et al. (2007) Molecular genetic analysis of porcine mannose-binding lectin genes, MBL1 and MBL2, and their association with complement activity. Int J Immunogenet. 34(1): 55-63.