Quick Order

Text Size:AAA

Mouse CLEC4F / CLECSF13 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4FcDNA Clone Product Information
cDNA Size:1647
cDNA Description:ORF Clone of Mus musculus C-type lectin domain family 4, member f DNA.
Gene Synonym:Kclr, D18063, Clecsf13, KUCR_MOUSE, Clec4f
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CLEC4F, a member of C-type lectins, was firstly purified from rat liver extract with high binding affinity to fucose, galactose and N-acetylgalactosamine, and un-sialylated glucosphingolipids with GalNAc or Gal terminus. However, the biological functions of CLEC4F have not been elucidated. Histochemical staining showed that mouse CLEC4F(mCLEC4F) is only expressed on F4/80+ cells localized in liver, and is undetectable in bone marrow, spleen, lymph nodes, or other tissues in adult mice. However, mCLEC4F is detected in the liver of embryonic day 11.5 (E11.5), which is 1.5 day earlier than the formation of liver (E10) and is 3.5 day earlier than the formation of bone marrow (E15-16). Moreover, recombinant mCLEC4F.Fc binds to alpha-galactoceramide in a Ca++-dependent manner, and both galactose and ceramide can partially inhibit CLEC4F.Fc binding to alpha-galactoceramide. Interestingly, mCLEC4F-deficient (mCEC4F k/o) mice produced far less cytokines than wild type littermates after intravenous injection ofalpha-galactoceramide. This suggests that mCLEC4F is not only a specific marker for Kupffer cells, but is also critical for the presentation of glycolipid antigen to NKT cells.

  • Shie-Liang Edmond Hsieh, et al. (2009) CLEC4F, A Kupffer Cells Specific Marker, Is Critical for Presentation of Alfa-Galactoceromide to NKT Cells. The Journal of Immunology. 182:78.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 2004 Jan;36(1):40-5.
  • Bonaldo MF, et al. (1996) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 1996 Sep;6(9):791-806.