Quick Order

Text Size:AAA

Rat HepaCAM2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat HEPACAM2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001106580.2
RefSeq ORF Size:1392bp
cDNA Description:Full length Clone DNA of Rattus norvegicus HEPACAM family member 2 with C terminal Flag tag.
Gene Synonym:RGD1305697, Hepacam2
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

HepaCAM2 belongs to the immunoglobulin family. HepaCAM2, together with HEPACAM1, are cell adhesion molecules. HEPACAM1 modulates cell adhesion and migration. It also inhibits cancer cell growth. HepaCAM2 contains 2 Ig-like C2-type (immunoglobulin-like) domains. The immunoglobulin domain is a type of protein domain that consists of a 2-layer sandwich of between 7 and 9 antiparallel β-strands arranged in two β-sheets with a Greek key topology. Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions.

References
  • Moh MC, et al. (2008) Expression of hepaCAM is downregulated in cancers and induces senescence-like growth arrest via a p53/p21-dependent pathway in human breast cancer cells. Carcinogenesis. 29(12):2298-305.
  • Moh MC, et al. (2005) Structural and functional analyses of a novel ig-like cell adhesion molecule, hepaCAM, in the human breast carcinoma MCF7 cells. J Biol Chem. 280(29):27366-74.
  • Chung Moh M, et al. (2005) Cloning and characterization of hepaCAM, a novel Ig-like cell adhesion molecule suppressed in human hepatocellular carcinoma. J Hepatol. 42(6):833-41.
  • Size / Price
    Catalog: RG80242-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"