After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PPM1A ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse PPM1A cDNA Clone Product Information
NCBI RefSeq:NM_008910.2
RefSeq ORF Size:1149bp
cDNA Description:Full length Clone DNA of Mus musculus protein phosphatase 1A, magnesium dependent, alpha isoform with N terminal His tag.
Gene Synonym:MMPa-2, MPPa-1, AI427932, AU017636, 2310003C21Rik, 2900017D14Rik, Ppm1a
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Protein phosphatase 1A (PPM1A / PP2CA) is an enzyme belonging to the PP2C family of Ser / Thr protein phosphatases. Members of PP2C family are negative regulators of cell stress response pathways and the MAP kinases and MAP kinase kinases. It has also been demonstrated to inhibit the activation of p38 and JNK kinase cascades. PPM1A dephosphorylates and promotes nuclear export of TGFβ-activated Smad2/3. Ectopic expression of PPM1A abolishes TGFβ-induced antiproliferative and transcriptional responses, whereas depletion of PPM1A enhances TGFβ signaling in mammalian cells. It has been demonstrated that PPM1A / PP2CA, through dephosphorylation of Smad2/3, plays a critical role in terminating TGFβ signaling. Overexpression of PPM1A is reported to activate the expression of the tumor suppressor gene TP53 / p53, which leads to cell apoptosis.

References
  • Lin X, et al. (2006) PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125(5): 915-28.
  • Marc F, et al. (2003) Protein phosphatase 2C binds selectively to and dephosphorylates metabotropic glutamate receptor 3. Proc Natl Acad. 100 (26): 16006-11.
  • Mann DJ, et al. (1992) Mammalian protein serine/threonine phosphatase 2C: cDNA cloning and comparative analysis of amino acid sequences. Biochim Biophys Acta. 1130 (1): 100-4.
  • Size / Price
    Catalog: MG50277-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"