After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CLEC10A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC10AcDNA Clone Product Information
Gene_bank_ref_id:NM_022393.2
cDNA Size:921
cDNA Description:ORF Clone of Rattus norvegicus C-type lectin domain family 10, member A DNA.
Gene Synonym:Mgl, Mgl1, Mgll, Clec10a
Species:Rat
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

CLEC10A, also known as the macrophage galactose-type calcium-type lectins (MGLs; CD301) constitute a unique class of C-type lectins because of their specificity for galactose and its structural homologues. MGLs/CD301 is a type II transmembrane glycoproteins and is expressed on macrophages and related cells of myeloid origins, particularly immature dendritic cells (DCs). There are 2 homologues: MGL1 and MGL2 (CD301a and CD301b) in mice. MGL1/CD301a induces both the production and secretion of interleukin (IL)-10. MGL1/CD301a plays a protective role against colitis by effectively inducing IL-10 production by colonic lamina propria macrophages in response to invading commensal bacteria.

References
  • Saba K, et al. (2009) A C-type lectin MGL1/CD301a plays an anti-inflammatory role in murine experimental colitis. Am J Pathol. 174(1): 144-52.
  • Suzuki N, et al. (2002) Molecular cloning and expression of cDNA encoding human macrophage C-type lectin: its unique carbohydrate binding specificity for Tn antigen. J Immunol. 1996 ;156: 128-135.
  • Tsuiji M, et al. (2002) Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J Biol Chem. 277: 28892-28901.
  • Denda-Nagai K, et al. (2002) Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens. Glycobiology. 12: 443-450.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"