After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat FCER2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FCER2cDNA Clone Product Information
cDNA Size:996
cDNA Description:ORF Clone of Rattus norvegicus Fc fragment of IgE, low affinity II, receptor for (CD23) DNA.
Gene Synonym:CD23, Fcer2a, MGC93219, Fcer2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Fc fragment of IgE, low affinity II, receptor for (CD23) or CD23 antigen is a member of the cluster of differentiation family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Physiologically, CD molecules can act in numerous ways, often acting as receptors or ligands (the molecule that activates a receptor) important to the cell. A signal cascade is usually initiated, altering the behavior of the cell (see cell signaling). Some CD proteins do not play a role in cell signaling, but have other functions, such as cell adhesion. CD23/FCER2 is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Increased levels of soluble CD23/FCER2 cause the recruitment of non-sensitised B-cells in the presentation of antigen peptides to allergen-specific B-cells, therefore increasing the production of allergen specific IgE. IgE, in turn, is known to upregulate the cellular expression of CD23 and Fc epsilon RI (high-affinity IgE receptor).

  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature. 358(6386): 505-7.
  • Punnonen J, et al. (1993) Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 90(8): 3730-4.
  • Yu P, et al. (1994) Negative feedback regulation of IgE synthesis by murine CD23. Nature. 369(6483): 753-6.