After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse NRN1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NRN1cDNA Clone Product Information
cDNA Size:429
cDNA Description:ORF Clone of Mus musculus neuritin 1 DNA.
Gene Synonym:Nrn, Cpg15, 0710008J23Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Neuritin 1 (NRN1) is a member of neuritin family. Neuritin is a glycosylphosphatidylinositol- anchored protein induced by neural activity. It is expressed in postmitotic-differentiating neurons of the developing nervous system and a population of small-diameter neurons in the dorsal root ganglia and was anterogradely and retrogradely transported. Neuritin message is induced by neuronal activity and by the activity-regulated neurotrophins BDNF, nerve growth factor (NGF) and NT-3. Purified recombinant neuritin promotes neurite outgrowth and arborization in primary embryonic hippocampal and cortical cultures. Thus, neuritin is considered as a downstream effector of activity-induced neurite outgrowth. In clinical, neuritin levels in diabetes were reduced in both dorsal root ganglia and sciatic nerve of rats, and these deficits were reversed in vivo by treatment with NGF. This manipulation of neuritin levels in diabetes may provide a potential target for the therapeutic intervention in the management of neuropathy.

  • Karamoysoyli E, et al. (2008) Neuritin mediates nerve growth factor-induced axonal regeneration and is deficient in experimental diabetic neuropathy. Diabetes. 57(1): 181-9.
  • Naeve GS, et al. (1997) Neuritin: A gene induced by neural activity and neurotrophins that promotes neuritogenesis. Proc Natl Acad Sci U S A. 94(6): 2648-2653.
  • Kojima N, et al. (2005) Expression of neuritin during liver maturation and regeneration. FEBS Lett. 579(21): 4562-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items