Quick Order

Mouse S100A10 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse S100A10 cDNA Clone Product Information
Gene_bank_ref_id:NM_009112.2
RefSeq ORF Size:294bp
cDNA Description:Full length Clone DNA of Mus musculus S100 calcium binding protein A10 (calpactin) with N terminal His tag.
Gene Synonym:42C, p10, p11, CAL12, CLP11, Cal1l, AA409961, AL024248, S100a10
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  
Protein S100-A10, also known as Calpactin I light chain, Cellular ligand of annexin II, S100 calcium-binding protein A10, p10 protein, p11, ANX2LG and S100A10, is a member of the S100 family of small, dimeric EF hand-type Ca(2+)-binding proteins that generally modulate cellular target proteins in response to intracellular Ca(2+) signals. In contrast to all other S100 proteins, S100A10 is Ca(2+) insensitive because of amino acid replacements in its Ca(2+)-binding loops that lock the protein in a permanently active state. S100A10 forms a heterotetramer with annexin IIH and promotes carcinoma invasion and metastasis by plasminogen activation. S100A10 and annexin II contribute to the aggressive characteristics of anaplastic carcinoma, while playing a constitutive role in papillary carcinoma. S100A10 induces the dimerization of ANXA2 / p36, it may function as a regulator of protein phosphorylation in that the ANXA2 monomer is the preferred target of tyrosine-specific kinase. S100A10 functions as a linker tethering certain transmembrane proteins to annexin A2 thereby assisting their traffic to the plasma membrane and/or their firm anchorage at certain membrane sites.

References
  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Ito,Y. et al., 2007, Anticancer Res. 27 (4C):2679-83.
  • Svenningsson,P. et al., 2007, Curr Opin Pharmacol  7 (1):27-32.
  • Rescher,U. et al., 2008, Pflugers Arch. 455 (4):575-82.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catalog: MG50252-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"