Quick Order

Text Size:AAA

Mouse CHK1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CHEK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_007691.4
RefSeq ORF Size:1431bp
cDNA Description:Full length Clone DNA of Mus musculus checkpoint kinase 1 homolog (S. pombe) with N terminal His tag.
Gene Synonym:Chk1, rad27, C85740, Chek1
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CHK1 / CHEK1 contains 1 protein kinase domain and belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family, NIM1 subfamily. It is a member of checkpoint kinases (Chks). Chks Checkpoint kinases (Chks) are serine/threonine kinases that are involved in the control of the cell cycle. There are two subtypes of chks that have so far been identified, CHK1 / CHEK1 and Chk2. They are essential components to delay cell cycle progression in normal and damaged cells and can act at all three cell cycle checkpoints. Chks are activated by phosphorylation. ATR kinase phosphorylates CHK1 / CHEK1 in response to single strand DNA breaks and ATM kinase phosphorylates Chk2 in response to double strand breaks. Chks phosphorylate Cdc25 phosphatase at Ser216, which leads to Cdc25 sequestration in the cytoplasm. Chks have a role in the physiological stress of hypoxia/reoxygenation. CHK1 / CHEK1 is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. CHK1 / CHEK1 may also negatively regulate cell cycle progression during unperturbed cell cycles.

References
  • Chen P, et al. (2000) The 1.7 a crystal structure of human cell cycle checkpoint kinase CHK1 / CHEK1: Implications for CHK1 / CHEK1 regulation. Cell. 100 (6): 681-92.
  • Sanchez Y, et al. (1997) Conservation of the CHK1 / CHEK1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science. 277 (5331): 1497-501.
  • Flaggs G, et al. (1998) Atm-dependent interactions of a mammalian CHK1 / CHEK1 homolog with meiotic chromosomes. Curr Biol. 7 (12): 977-86.
  • Chini CC, et al. (2005) Claspin, a regulator of CHK1 / CHEK1 in DNA replication stress pathway. DNA Repair. 3 (8-9): 1033-7.
  • Size / Price
    Catalog: MG50248-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"