Quick Order

Mouse DKK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
DKK3cDNA Clone Product Information
Gene Bank Ref.ID:NM_015814.2
cDNA Size:1050
cDNA Description:ORF Clone of Mus musculus dickkopf homolog 3 (Xenopus laevis) DNA.
Gene Synonym:C87148, AW061014, Dkk3
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

DKK3 (dickkopf related protein 3) is a member of the dickkopf-related family consisting of DKK1, DKK2, DKK3 and DKK4. It is a secreted protein, and also known as REIC (Reduced Expansion in Immortalized Cells). The DKK3 protein is proposed to function as a secreted tumor suppressor since it is downregulated in a number of cancer cells and prostate cancer tissue and may be a promising candidate molecule for therapeutic interference. DKK3 protein is also a negative regulator of beta-catenin and its downregulation contribute to an activation of the beta-catenin signaling pathway.

Reference
  • Yue W, et al., 2008. Downregulation of Dkk3 activates beta-catenin/TCF-4 signaling in lung cancer. Carcinogenesis, 29 (1): 84-92.
  • Ding Z, et al., 2009. Promoter methylation and mRNA expression of DKK3 and WIF-1 in hepatocellular carcinoma. World J Gastroenterol, 15 (21):2595-601.
  • Size / Price
    Catalog:MG50247-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"