Quick Order

Mouse ECSIT Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ECSITcDNA Clone Product Information
Gene_bank_ref_id:NM_001253897.1
cDNA Size:1308
cDNA Description:ORF Clone of Mus musculus ECSIT homolog (Drosophila) DNA.
Gene Synonym:Sitpec
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

ECSIT is an adapter protein of the toll-like and IL-1 receptor signaling pathway that is involved in the activation of NF-kappa-B via MAP3K1. Activation of NF-kappaB as a consequence of signaling through the Toll and IL-1 receptors is a major element of innate immune responses. ECSIT is specific for the Toll/IL-1 pathways and is a regulator of MEKK-1 processing. It bridges TRAF6 to MEKK-1. Expression of wild-type ECSIT accelerates processing of MEKK-1, whereas a dominant-negative fragment of ECSIT blocks MEKK-1 processing and activation of NF-kappaB. ECSIT is also required for normal embryonic development and efficient assembly of mitochondrial NADH:ubiquinone oxidoreductase.

References
  • Kopp E. et al., 1999, Genes Dev. 13 (16): 2059-71.
  • The MGC Project Team. 2004, Genome Res. 14: 2121-7.
  • Vogel RO. et al., 2007, Genes Dev. 21: 615-24.
  • Size / Price
    Catalog:MG52140-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"