After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1707bp
cDNA Description:Full length Clone DNA of Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) HA with N terminal Flag tag.
Gene Synonym:HA1, Hemagglutinin
Species:H5N1
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-H5N1-CE-06-HA
Restriction Site:KpnI + XbaI (6kb + 1.8kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABG81039.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag on other vectors
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11686-ACG$345
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11686-ACR$345
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11686-C$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11686-CF$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11686-CH$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11686-CM$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11686-CY$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11686-NF$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11686-NH$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11686-NM$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11686-NY$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11686-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11686-NF
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"