After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CST7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST7cDNA Clone Product Information
cDNA Size:504
cDNA Description:ORF Clone of Mus musculus cystatin F (leukocystatin) DNA.
Gene Synonym:CMAP, MGC151424, MGC151426, Cst7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms and are divided into three classes. Cystatin F, also known as leukocystatin and CMAP (Cystatin-like Metastasis-Associated Protein), is a type 2 cystatin and its expression is limited to hematopoietic cells, with the highest expression levels being observed in monocytes, dendritic cells, and certain types of T-cells. Furthermore, cystatin F mRNA becomes up-regulated during dendritic cell maturation, and thus suggests a specific role of cystatin F in immune regulation. Cystatin F is produced as a dimer, an inactive cathepsin inhibitor which is activated by chemical reduction. In addition, Cystatin F and its homologues have been observed expressing in various human cancer cell lines established from malignant tumors, and thus indicates a new diagnosis and prevention approach of certain human carcinomas metastasis.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items