After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human cytomegalovirus (HCMV) gB ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CMV GB cDNA Clone Product Information
Gene_bank_ref_id:AY315197.2
RefSeq ORF Size:2724bp
cDNA Description:Full length Clone DNA of Homo cytomegalovirus gB with N terminal Flag tag.
Gene Synonym:gB
Species:CMV
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-GB
Restriction Site:KpnI + XbaI (6kb + 2.72kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Human cytomegalovirus (CMV) (human herpesvirus 5) glycoprotein B, also referred as CMV gB or gB, which belongs to the herpesviridae glycoprotein B family. It is a 907-amino acid glycoprotein encoded by the ORF of UL55. Cytomegalovirus Glycoprotein B protein is the most abundant component of the envelope, a target of neutralizing antibodies with at least two defined neutralizing epitopes and an essential replication component. Cytomegalovirus Glycoprotein B protein plays important roles in HCMV entry, cell-cell spread of internal virions, and fusion of infected cells. In addition, Cytomegalovirus Glycoprotein B protein is one envelope protein capable of heparin binding. It forms a physical association with host cell annexin II independent of the presence of calcium.

References
  • Lopper M,et al. (2002). Disulfide bond configuration of human cytomegalovirus glycoprotein B. J Virol. 76(12): 6073-82.
  • Isaacson MK, et al. (2009) Human cytomegalovirus glycoprotein B is required for virus entry and cell-to-cell spread but not for virion attachment, assembly, or egress. J Virol. 83(8): 3891-903.
  •  

     
    Size / Price
    Catalog: VG10202-NF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"