Quick Order

Mouse S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A6cDNA Clone Product Information
cDNA Size:270
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A6 (calcyclin) DNA.
Gene Synonym:2A9, PRA, 5B10, Cacy, CALCYCLIN, S100a6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. S100A6 (S100 calcium binding protein A6) is a member of the S100 family of proteins, and functions in prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of S100A6 have been implicated in melanoma.

  • Schäfer, B.W. et al., 1996, Trends Biochem. Sci. 21 (4): 134-140.
  • Donato,R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Nowotny, M. et al., 2003, J. Biol. Chem. 278 (29): 26923-26928.
  • Nonaka D, et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Marenholz, I. et al., 2004, Biochem. Biophys. Res. Commun. 322 (4): 1111-22. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items