Quick Order

Text Size:AAA

Rat LEFTY2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat LEFTY2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001007556.1
RefSeq ORF Size:1101bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Left-right determination factor 2 with C terminal Flag tag.
Gene Synonym:Ebaf2, Lefty2
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

left-right determination factor 2 (Lefty2), also known as Left-right determination factor A (Lefty A), endometrial bleeding associated factor (left-right determination, factor A transforming growth factor beta superfamily), and Transforming growth factor beta-4, is a member of the TGF-beta family of proteins. This protein is secreted and plays a role in left-right asymmetry determination of organ systems during development. Lefty2/Lefty A may also play a role in endometrial bleeding. Mutations in Lefty2/Lefty A have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. Alternative processing of this protein can yield three different products. Depletion of both Lefty1 and Lefty2 causes unchecked Nodal signaling, expansion of mesendoderm, and loss of ectoderm. The expansion of mesendoderm correlates with an extended period of rapid cellular internalization and a failure of deep-cell epiboly. The gastrulation defects of embryos depleted of Lefty1 and Lefty2 result from the deregulation of Squint signaling.

References
  • Feldman B, et al. (2002) Lefty antagonism of Squint is essential for normal gastrulation. Curr Biol. 12(24): 2129-35.
  • Meno C, et al. (1999) Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol Cell. 4(3): 287-98.
  • Meno C, et al. (2001) Diffusion of nodal signaling activity in the absence of the feedback inhibitor Lefty2. Dev Cell. 1(1): 127-38.
  • Size / Price
    Catalog: RG80129-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"