After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse S100A7A ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse S100A7A cDNA Clone Product Information
NCBI RefSeq:NM_199422.1
RefSeq ORF Size:327bp
cDNA Description:Full length Clone DNA of Mus musculus S100 calcium binding protein A7A with N terminal His tag.
Gene Synonym:Gm1020, S100A7f, S100a15, AY465109, S100A7L1, MGC130261, MGC130262, S100a17l1, S100a7a
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Koebnerisin is also known as protein S100-A7A (S100A7A), S100 calcium-binding protein A7-like 1 (S100A7L1) or S100 calcium-binding protein A15 (S100A15). Human S100A7A / S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype. The association of the 11.2 kDa S100A7A / S100A15 with psoriasis suggests that it contributes to the pathogenesis of the disease and could provide a molecular target for therapy. 

References
  • Wolf R, et al. (2009) Highly homologous hS100A15 and hS100A7 proteins are distinctly expressed in normal breast tissue and breast cancer. Cancer Lett. 277 (1): 101-7.
  • Buchau AS, et al. (2007) S100A15, an antimicrobial protein of the skin: regulation by E. coli through Toll-like receptor 4. J Invest Dermatol. 127 (11): 2596-604.
  • Boeshans KM, et al. (2006) Purification, crystallization and preliminary X-ray diffraction of human S100A15. Acta Crystallogr Sect F Struct Biol Cryst Commun. 62 (5): 467-70.
  • Size / Price
    Catalog: MG50226-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"