After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse MCPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MCPT1cDNA Clone Product Information
cDNA Size:675
cDNA Description:ORF Clone of Mus musculus mast cell protease 1 DNA.
Gene Synonym:Mcp-1, AV080368, Mcpt1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Mouse Mast Cell Protease 1 (MMCP-1), also known as MCP-1, MCPT-1 and β-chymase, is a member of the Chymase family of chymotrypsin-like serine proteases. MCPT-1 is a 26 kDa β-chymase that is a component of mast cell granules. It is a 226 amino acid (aa) protein that has a conserved pattern of six cysteines and one potential glycosylation site. The granule-derived mouse mast cell proteases-1 and -2 (mMCP-1 and -2) colocalize in similar quantities in mucosal mast cells but micrograms of mMCP-1 compared with nanograms of mMCP-2 are detected in peripheral blood during intestinal nematode infection. mMCP-1 isolated from serum is complexed with serpins and both the accumulation and the longevity of mMCP-1 in blood is due to complex formation, protecting it from a pathway that rapidly clears mMCP-2, which is unable to form complexes with serpins. The mucosal mast cell (MMC) granule-specific beta-chymase, mouse mast cell protease-1 (mMCP-1), is released systemically into the bloodstream early in nematode infection before parasite-specific IgE responses develop and TGF-beta1 induces constitutive release of mMCP-1 by homologues of MMC in vitro. Expression of mMCP-1 is largely restricted to intraepithelial MMC and is thought to play a role in the regulation of epithelial permeability. Its activation is completed by the removal of a two residue N-terminal propeptide by a dipeptidyl peptidase (Cathepsin C). MCPT-1 is upregulated in the intestine in response to nematode infection, or in systemic mucosa in response to anaphylaxis. Like human α-chymase, MCPT-1 is capable of the conversion of angiotensin I to angiotensin II, which plays a key role in the regulation of arterial pressure. The intestinal inflammation associated with gastrointestinal helminths is partly mediated by mMCP-1.

  • Pemberton AD, et al. (2003) Purification and characterization of mouse mast cell proteinase-2 and the differential expression and release of mouse mast cell proteinase-1 and -2 in vivo. Clin Exp Allergy. 33(7): 1005-12.
  • Brown JK, et al. (2003) Constitutive secretion of the granule chymase mouse mast cell protease-1 and the chemokine, CCL2, by mucosal mast cell homologues. Clin Exp Allergy. 33(1): 132-46.
  • Lawrence CE, et al. (2004) Mouse mast cell protease-1 is required for the enteropathy induced by gastrointestinal helminth infection in the mouse. Gastroenterology. 127(1): 155-65.
  • Pemberton AD, et al. (2006) Anaphylactic release of mucosal mast cell granule proteases: role of serpins in the differential clearance of mouse mast cell proteases-1 and -2. J Immunol. 176(2): 899-904.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items