Quick Order

Text Size:AAA

Rat CCL27 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CCL27 cDNA Clone Product Information
Gene_bank_ref_id:NM_001108660.1
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) ligand 27 with C terminal Flag tag.
Gene Synonym:Ccl27
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Background

CCL27, also known as CTACK, is a small cytokine belonging to the CC chemokine family. Members of this family are proteins characterized by two adjacent cysteines. CCL27 is chemotactic for skin-associated memory T lymphocytes. CCL27 may also play a role in mediating homing of lymphocytes to cutaneous sites. CCL27 plays a pivotal role in establishing the inflammatory infiltrate characteristic for common inflammatory skin diseases. Through binding to the chemokine receptor 10 (CCR10), CCL27 mediates inflammation by promoting lymphocyte migration into the skin.

References
  • Morales. et al., 1999, Proc Natl Acad Sci. 96: 14470-5.
  • Homey. et al., 2002, J Immunol. 164: 3465-70.
  • Ishikawa-Mochizuki. et al., 1999, FEBS Lett. 460: 544-8.
  • Size / Price
    Catalog: RG80085-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"