Quick Order

Text Size:AAA

Mouse S100A13 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A13cDNA Clone Product Information
cDNA Size:297
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A13 DNA.
Gene Synonym:S100a13
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse S100A13 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  Protein S100-A13, also known as S100 calcium-binding protein A13, is a member of the S-100 family. It contains two EF-hand domains. S100A13 binds two calcium ions per subunit and one copper ion. Binding of one copper ion does not interfere with calcium binding. S100A13 is required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine. S100A13 plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway.

  • Mandinova A. et al., 2003, J Cell Sci. 116: 2687-96.
  • Arnesano F. et al., 2005, Angew Chem Int Ed. 44: 6341-4.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items