Quick Order

Text Size:AAA

Human ACHE Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACHEcDNA Clone Product Information
Gene_bank_ref_id:NM_000665.3
cDNA Size:1845
cDNA Description:ORF Clone of Homo sapiens acetylcholinesterase DNA.
Gene Synonym:YT, ACEE, ARACHE, N-ACHE
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Acetylcholinesterase, also known as ACHE, is an enzyme that degrades (through its hydrolytic activity) the neurotransmitter acetylcholine, producing choline and an acetate group. Acetylcholinesterase plays a crucial role in nerve impulse transmission at cholinergic synapses by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE appears to be a potential therapeutic target at muscle injuries including organophosphate myopathy. It is an externally oriented membrane-bound enzyme and its main physiological role is termination of chemical transmission at cholinergic synapses and secretory organs by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE plays important roles in the cholinergic system, and its dysregulation is involved in a variety of human diseases. ACHE was significantly down-regulated in the cancerous tissues of 69.2% of hepatocellular carcinoma (HCC) patients, and the low ACHE expression in HCC was correlated with tumor aggressiveness, an elevated risk of postoperative recurrence, and a low survival rate. Both the recombinant ACHE protein and the enhanced expression of ACHE significantly inhibited HCC cell growth in vitro and tumorigenicity in vivo. ACHE as a tumor growth suppressor in regulating cell proliferation, the relevant signaling pathways, and the drug sensitivity of HCC cells. Thus, ACHE is a promising independent prognostic predictor for HCC recurrence and the survival of HCC patients. ACHE is responsible for the hydrolysis of acetylcholine in the nervous system. It is inhibited by organophosphate and carbamate pesticides. However, this enzyme is only slightly inhibited by organophosphorothionates.

References
  • Zhao Y, et al. (2011) Acetylcholinesterase, a key prognostic predictor for hepatocellular carcinoma, suppresses cell growth and induces chemosensitization. Hepatology. 53(2): 493-503.
  • Roepcke CB, et al. (2010) Analysis of phosphorothionate pesticides using a chloroperoxidase pretreatment and acetylcholinesterase biosensor detection. J Agric Food Chem. 58(15): 8748-56.
  • Zaheer-ul-Haq, et al. (2010) Benchmarking docking and scoring protocol for the identification of potential acetylcholinesterase inhibitors. J Mol Graph Model. 28(8): 870-82.
  • Pegan K, et al. (2010) Acetylcholinesterase is involved in apoptosis in the precursors of human muscle regeneration. Chem Biol Interact. 187(1-3): 96-100.
  • Size / Price
    Catalog:HG15847-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"