After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PLA2G2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLA2G2AcDNA Clone Product Information
Gene_bank_ref_id:NM_001082531.1
cDNA Size:441
cDNA Description:ORF Clone of Mus musculus phospholipase A2, group IIA (platelets, synovial fluid) DNA.
Gene Synonym:EF, Mom1, Pla2, sPLA2, sPla2-IIA, Pla2g2a
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Phospholipase A2, membrane associated, also known as Phosphatidylcholine 2-acylhydrolase 2A, Group IIA phospholipase A2, Non-pancreatic secretory phospholipase A2 and PLA2G2A, is a peripheral membrane protein which belongs to the phospholipase A2 family. PLA2G2A is found in many cells and also extracellularly. The membrane-bound and secreted forms of PLA2G2A are identical. PLA2G2A has been proposed to play a role in anti-bacterial defense, inflammation and eicosanoid generation, in clearance of apoptotic cells, and in the Wnt signaling pathway. PLA2G2A is thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. PLA2G2A catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. PLA2G2A might be a factor in human colorectal tumorigenesis.

References
  • Praml,C. et al., 1998, Oncogene. 17 (15):2009-12.
  • Fijneman,R.J. et al., 2008,Front Biosci 13 :4144-74.
  • Fijneman,R.J. et al., 2009, Cell Oncol  31 (5):345-56.
  • Size / Price
    Catalog:MG50203-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"