Quick Order

Mouse FGFR4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FGFR4cDNA Clone Product Information
cDNA Size:2400
cDNA Description:ORF Clone of Mus musculus fibroblast growth factor receptor 4 DNA.
Gene Synonym:Fgfr-4, Fgfr4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Fibroblast Growth Factor (FGF) & Receptor Related Products
Product nameProduct name
Cynomolgus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human aFGF / FGF1 ProteinHuman bFGF / FGF2 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF10 ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGF21 Protein (His Tag)Human FGFBP3 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinHuman FGF18 / FGF-18 Protein (His Tag)Human FGF14 / SCA27 Protein (isoform 1B)Cynomolgus FGFR3 Protein (Fc Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse / Rat aFGF / FGF1 ProteinMouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Canine aFGF / FGF1 ProteinCanine FGF12 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus aFGF / FGF1 ProteinCynomolgus FGFR1 / CD331 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)

Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to fibroblast growth factor receptor, is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR4/CD334 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR4/CD334 preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. FGFR4/CD334 signaling is down-regulated by receptor internalization and degradation; MMP14 promotes internalization and degradation of FGFR4/CD334. Mutations in FGFR4/CD334 lead to constitutive kinase activation or impair normal FGFR4 inactivation lead to aberrant signaling.

  • Hart KC, et al. (2000) Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene. 19(29): 3309-20.
  • Xie MH, et al. (1999) FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine. 11(10): 729-35.
  • Yu C, et al. (2000) Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem. 275(20): 15482-9.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks