After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse COLEC10 / CLL1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse COLEC10 cDNA Clone Product Information
Gene_bank_ref_id:NM_173422.2
RefSeq ORF Size:834bp
cDNA Description:Full length Clone DNA of Mus musculus collectin sub-family member 10 with N terminal His tag.
Gene Synonym:CL-L1, MGC123727, MGC123950, MGC123951, Colec10
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

COLEC10 is a member of the C-lectin family. Members of this family possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins.

Size / Price
Catalog: MG50189-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"