Quick Order

Mouse FGFRL1 / FGFR5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FGFRL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_054071.1
RefSeq ORF Size:1590bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor receptor-like 1 with N terminal His tag.
Gene Synonym:FGFR5, FGFR5beta, FGFR5gamma, Fgfrl1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human bFGF / FGF2 ProteinHuman aFGF / FGF1 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Human FGF10 / KGF2 ProteinMouse / Rat aFGF / FGF1 ProteinMouse FGFR3 / CD333 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Human FGF21 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human FGF18 / FGF-18 Protein (His Tag)Rat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGF14 / SCA27 Protein (isoform 1B)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGFBP3 Protein (His Tag)Cynomolgus FGFR3 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Human FGF6 / FGF-6 ProteinMouse FGFR2 / CD332 Protein (His Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Cynomolgus aFGF / FGF1 ProteinCanine FGF12 ProteinCanine aFGF / FGF1 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)
Background

Fibroblast growth factor receptor-like 1 (FGFRL1) also known as Fibroblast growth factor receptor 5 (FGFR5), is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A unique feature of FGFRL1/FGFR5 is that it does not contain an intracellular tyrosine kinase domain. Some muscle types, including the muscles of the tongue and the diaphragm, express FGFRL1/FGFR5 at relatively high level. In contrast, the heart and the skeletal muscles of the limbs, as well as many other organs (brain, lung, liver, kidney, gut) express Fgfrl1 only at basal level. It is conceivable that FGFRL1/FGFR5 interacts with other Fgfrs, which are expressed in cartilage and muscle, to modulate FGF signaling.

References
  • Wiedemann M, et al. (2000) Characterization of a novel protein (FGFRL1) from human cartilage related to FGF receptors. Genomics. 69(2): 275-9.
  • Trueb B, et al. (2006) Expression of FGFRL1, a novel fibroblast growth factor receptor, during embryonic development. Int J Mol Med. 17(4): 617-20.
  • Wiedemann M, et al. (2001) The mouse Fgfrl1 gene coding for a novel FGF receptor-like protein. Biochim Biophys Acta. 1520(3): 247-50.
  • Trueb B, et al. (2003) Characterization of FGFRL1, a novel fibroblast growth factor (FGF) receptor preferentially expressed in skeletal tissues. J Biol Chem. 278(36): 33857-65.
  • Size / Price
    Catalog: MG50182-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"