Quick Order

Text Size:AAA

Mouse APOE Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
APOEcDNA Clone Product Information
cDNA Size:936
cDNA Description:ORF Clone of Mus musculus apolipoprotein E DNA.
Gene Synonym:AI255918
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid residues. There are three isoforms in human (apoE2, apoE3, and apoE4) due to different amino acid residues at positions 112 and 158. ApoE is synthesized predominantly in the liver, but also by cells in the spleen, brain, lung, kidney, ovary, adrenal, and muscle tissues. Hepatic parenchyma cells are the main apoE producing cells in mammalian body, probably accounting for two thirds to three fourths of the plasma apoE . In the nervous system, apoE mRNA is present in neurons, astrocytes, ependymal cells, nonmyelinating Schwann cells, but not in microglia, oligodendroglia, choroidal cells, or myelinating Schwann cells. ApoE produced by mammalian cells exists in different forms, monomers, dimers, modified, unmodified, lipid-rich, and lipid-poor, and so forth. ApoE plays a double-role in immune responses. Both apoE containing lipoproteins and multimers of synthetic apoE peptides inhibited proliferation of cultured lymphocytes by inhibiting DNA synthesis and reducing phospholipid turnover in T cells. ApoE can also affect innate and acquired immune responses in vitro by its ability to suppress stimulation of cultured neutrophils. ApoE can bind lipopolysaccharide (LPS), attenuate the inflammatory response, and thus reduce LPS induced lethality. Injection of LPS stimulated higher expression of inflammatory cytokines like interleukin (IL)-1β, IL-12, and interferon-γ (IFN-γ), as well as IL-6.

  • Mahley RW. (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science. 240(4852): 622-30.
  • Aleshkov S, et al. (1989) Interaction of nascent apoe2, apoe3, and apoe4 isoforms expressed in mammalian cells with amyloid peptide. Relevance to Alzheimer's disease. Biochemistry. 36(34): 10571-80.
  • Hussain MM, et al. (1997) Synthesis, modification, and flotation properties of rat hepatocyte apolipoproteins. Biochimica et Biophysica Acta. 101(1): 90-101.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items