Quick Order

Rat B7-2 / CD86 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD86 cDNA Clone Product Information
Gene_bank_ref_id:NM_020081.1
RefSeq ORF Size:942bp
cDNA Description:Full length Clone DNA of Rattus norvegicus CD86 molecule with C terminal Flag tag.
Gene Synonym:B7-2, Cd86
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell surface immunoglobulin superfamily. B7-2 exists predominantly as a monomer on cell surfaces and interacts with two co-stimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus induces the signal pathways which regulate T cell activation and tolerance, cytokine production, and the generation of CTL. It is indicated that contacts between B and T helper cells mediated by CD86 encourage signals for the proliferation and IgG secretion of normal B cells and B cell lymphomas. Recent study has revealed that CD86 also promotes the generation of a mature APC repertoire and promotes APC function and survival. CD86 has an important role in chronic hemodialysis, allergic pulmonary inflammation, arthritis, and antiviral responses, and thus is regarded as a promising candidate for immune therapy.

References
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • Rau FC, et al. (2009) B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. J Immunol. 183(12): 7661-71.
  • Dai ZS, et al. (2009) Defective expression and modulation of B7-2/CD86 on B cells in B cell chronic lymphocytic leukemia. Int J Hematol. 89(5): 656-63.
  • Size / Price
    Catalog: RG80025-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"