Quick Order

Human ETHE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ETHE1cDNA Clone Product Information
cDNA Size:765
cDNA Description:ORF Clone of Homo sapiens ethylmalonic encephalopathy 1 DNA.
Gene Synonym:HSCO, YF13H12
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

ETHE1, also known as HSCO, is a sulfur dioxygenase that localizes within the mitochondrial matrix. ETHE1 probably plays an important role in metabolic homeostasis in mitochondria. It may also function as a nuclear-cytoplasmic shuttling protein that binds transcription factor RELA/NFKB3 in the nucleus and exports it to the cytoplasm. ETHE1 can suppresses p53-induced apoptosis by preventing nuclear localization of RELA. Mutations in ETHE1 gene result in ethylmalonic encephalopathy. Ethylmalonic encephalopathy is an autosomal recessive, invariably fatal disorder characterized by early-onset encephalopathy, microangiopathy, chronic diarrhea, defective cytochrome c oxidase (COX) in muscle and brain, high concentrations of C4 and C5 acylcarnitines in blood and high excretion of ethylmalonic acid in urine.

  • Higashitsuji. et al., 2002, Cancer Cell. 2 (4): 335-46.
  • McCoy JG. et al., 2007, Acta Crystallogr D Biol Crystallogr. 62 (9): 964-70.
  • Mehrle A. et al., 2006, Nucleic Acids Res. 34: D415-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks