After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD16a ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat FCGR3A cDNA Clone Product Information
Gene_bank_ref_id:NM_207603.1
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Fc fragment of IgG, low affinity IIIa, receptor with C terminal Flag tag.
Gene Synonym:Fcgr4, Fcgr3a
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The Fc receptor with low affinity for IgG (FCGR3, or CD16) is encoded by 2 nearly identical genes, FCGR3A and FCGR3B, resulting in tissue-specific expression of alternative membrane-anchored isoforms. FCGR3A, it is also known as CD16a, encodes a transmembrane protein expressed on activated monocytes/macrophages, natural killer (NK) cells, and a subset of T cells.

CD16a / FCGR3A is a receptor expressed on NK cells that facilitates antibody dependent cellular cytotoxicity (ADCC) by binding to the Fc portion of various antibodies. CD16a / FCGR3A also has a broader function. CD16a / FCGR3A is directly involved in the lysis of some virus-infected cells and tumor cells by NK cells, independent of antibody binding. Cross-linking of CD16a / FCGR3A on NK cells resulted in increased intracellular Ca2+ levels and a cascade of biochemical events similar to those activated by the T cell receptor. CD16a / FCGR3A on human NK cells is a lysis receptor that mediates the direct killing of some virus infected and tumor cells, independent of antibody ligation.

References
  1. David Dornan, et al. Effect of FCGR2A and FCGR3A variants on CLL outcome. Blood. 2010 116: 4212-4222
  2. Edberg JC, et al. (2002) Genetic linkage and association of Fc gamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  3. Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  4. Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
Size / Price
Catalog: RG80017-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"