Quick Order

Text Size:AAA

Mouse BMP-3b / GDF-10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GDF10cDNA Clone Product Information
Gene_bank_ref_id:NM_145741.2
cDNA Size:1431
cDNA Description:ORF Clone of Mus musculus growth differentiation factor 10 DNA.
Gene Synonym:Gdf10
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Background

BMP-3b / GDF-10 is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in mice suggest that the protein encoded by this gene plays a role in skeletal morphogenesis. In the bone morphogenetic cascade, cartilage differentiation, hypertrophy, and cell death are followed by bone formation. In this regard, all BMPs are cartilage morphogenetic proteins since cartilage is formed first. An overexpression or dysregulation of BMP pathways may lead to heterotopic bone formation or fibrodysplasia ossificans progressiva (FOP). BMPs have been implicated in FOP. The pioneering work of Sakou has implicated BMP-3b / GDF-10 in ossification of the posterior longitudinal ligament of the spine in Japanese patients. The BMP-specific antagonists such as noggin or chordin might be used therapeutically in clinical conditions with pathologically excessive bone formation. The osteoinductive capacity of BMPs has been demonstrated in preclinical models, and the efficacy of BMPs for the treatment of orthopaedic patients is now being evaluated in clinical trials. It was suggested that further progress in the clinical application of the BMP-3b / GDF-10 will depend upon the development of carriers with ideal release kinetics for the delivery of the BMPs.

References
  • Hino J, Takao M, Takeshita N, et al. (1996). "cDNA cloning and genomic structure of human bone morphogenetic protein-3B (BMP-3b).". Biochem. Biophys. Res. Commun. 223 (2): 304–10.
  • Kimura K, Toyooka S, Tsukuda K, et al. (2008). "The aberrant promoter methylation of BMP3b and BMP6 in malignant pleural mesotheliomas.". Oncol. Rep. 20 (5): 1265-8.
  • A. H. Reddi. (2001) Bone Morphogenetic Proteins: From Basic Science to Clinical Applications. Scientific Article. 83:1-6.
  • Size / Price
    Catalog:MG50165-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"