After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TLR3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TLR3 cDNA Clone Product Information
Gene_bank_ref_id:NM_126166.4
RefSeq ORF Size:2718bp
cDNA Description:Full length Clone DNA of Mus musculus toll-like receptor 3 with N terminal His tag.
Gene Synonym:AI957183
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Toll-like receptor 3 (TLR3) also known as CD283 (cluster of differentiation 283) is a member of the Toll-like receptor family of pattern recognition receptors of the innate immune system. TLR3/CD283 plays a fundamental role in pathogen recognition and activation of innate immunity. TLR3 is a nucleotide-sensing TLR which is activated by double-stranded RNA, a sign of viral infection. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses.

References
  • Muzio M, et al.. (2000) Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J Immunol. 164(11): 5998-6004.
  • Doyle S, et al.. (2002) IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity. 17(3): 251-63.
  • Choe J, et al.. (2005) Crystal structure of human toll-like receptor 3 (TLR3) ectodomain. Science. 309(5734): 581-5.
  • Size / Price
    Catalog: MG50161-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"