Quick Order

Text Size:AAA

Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SRCcDNA Clone Product Information
cDNA Size:1626
cDNA Description:ORF Clone of Mus musculus Rous sarcoma oncogene transcript variant 1 DNA.
Gene Synonym:AW259666, pp60c-src, Src
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG51118-ACG$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG51118-ACR$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG51118-ANG$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG51118-ANR$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG51118-CF$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG51118-CH$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG51118-CM$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG51118-CY$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone)MG51118-G$195
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedMG51118-G-F$395
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG51118-NF$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG51118-NH$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG51118-NM$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG51118-NY$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG51118-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.