Quick Order

Text Size:AAA

Mouse ESM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ESM1cDNA Clone Product Information
cDNA Size:555
cDNA Description:ORF Clone of Mus musculus endothelial cell-specific molecule 1 DNA.
Gene Synonym:ESM-1, AV004503, 0610042H23Rik, Esm1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

ESM1 is a secreted protein which is produced by adipocytes. It has been noticed that ESM1 may play some role in obesity-associated vascular disease since circulating ESM-1 levels are reduced in the overweight and obese. ESM1 is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of ESM1 gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. Recently, ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF or FGF-2. In hypervascularized cancers, overexpression of endocan has been detected by immunohistochemistry using monoclonal antibodies against ESM1.

  • Cong R, et al. (2006) Hhex is a direct repressor of endothelial cell-specific molecule 1 (ESM-1). Biochem. Biophys Res Commun. 346(2):535-45.
  • Aitkenhead M, et al. (2002) Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM. Microvasc Res. 63(2): 159-71.
  • Lassalle P, et al. (1996) ESM-1 is a novel human endothelial cell-specific molecule expressed in lung and regulated by cytokines. J Biol Chem. 271(34):20458-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks