Quick Order

Text Size:AAA

Rat GpT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
GPTcDNA Clone Product Information
Gene Bank Ref.ID:NM_031039.1
cDNA Size:1491
cDNA Description:ORF Clone of Rattus norvegicus glutamic-pyruvate transaminase (alanine aminotransferase) DNA.
Gene Synonym:Gpt1, Gpt
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (GPT), is a pyridoxal enzyme which belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family, Alanine aminotransferase subfamily. Gpt / Gpt1 / ALT catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. Gpt / Gpt1 / ALT is expressed in Liver, kidney, heart, and skeletal muscles and it expresses at moderate levels in the adipose tissue. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. GPT1/GPT is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis.

  • Bergmeyer HU, et al. (1978) Optimization of methods for aspartate aminotransferase and alanine aminotransferase. Clin Chem. 24(1): 58-73.
  • King MC, et al. (1980) Allele increasing susceptibility to human breast cancer may be linked to the glutamate-pyruvate transaminase locus. Science. 208(4442): 406-8.
  • Prati D, et al. (2002) Updated definitions of healthy ranges for serum alanine aminotransferase levels. Ann Intern Med. 137(1): 1-10.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks