Quick Order

Text Size:AAA

Mouse SHH Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SHHcDNA Clone Product Information
cDNA Size:1314
cDNA Description:ORF Clone of Mus musculus sonic hedgehog DNA.
Gene Synonym:Hx, Dsh, Hhg1, Hxl3, M100081, 9530036O11Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Sonic HedgeHog, also known as sonic hedgehog protein, belongs to the hedgehog family. It cannot be detected in adult tissues while can be found in fetal intestine, liver, lung, and kidney. Sonic HedgeHog is a protein that is vital in guding the early embryo. It has been associated as the major inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Sonic HedgeHog intercellular signal is essential for a various patterning events during development: signal produced by the notochord that induces ventral cell fate in the neural tube and somites, and the polarizing signal for patterning of the anterior-posterior axis of the developing limb bud. Sonic HedgeHog binds to the patched receptor, which functions in association with smoothened, to activate the transcription of target genes. In the absence of sonic HedgeHog, patched receptor represses the constitutive signaling activity of smoothened. Sonic HedgeHog also regulates another factor, the gli oncogene. Defects in sonic hedgehog can cause microphthalmia isolated with coloboma type 5, triphalangeal thumb-polysyndactyly syndrome and holoprosencephaly type 3.

  • Ericson J, et al. (1997) Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol. 62:451-66.
  • Marigo V, et al. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc Natl Acad Sci. 93(18):9346-51.
  • Stone DM, et al. (1996) he tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 384:129-34.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks