After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse LY96 / MD-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LY96cDNA Clone Product Information
Gene_bank_ref_id:NM_016923.2
cDNA Size:483
cDNA Description:ORF Clone of Mus musculus lymphocyte antigen 96 DNA.
Gene Synonym:MD2, MD-2, ESOP-1
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

LY-96, also known as ESOP-1, is a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS). LY-96 also cooperates with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. It enhances TLR4-dependent activation of NF-kappa-B. ESOP-1 has 160 amino acids, the sequence of which shows 64% identity with human ESOP-1/MD-2. ESOP-1 mRNA is highly expressed in the mouse embryos at 7.5 days after coitus.

Size / Price
Catalog:MG51098-CH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"