After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rabbit ERBB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ERBB3cDNA Clone Product Information
Gene_bank_ref_id:XM_002711067.1
cDNA Size:4026
cDNA Description:ORF Clone of Rabbit v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) DNA.
Gene Synonym:ERBB3
Species:Rabbit
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinHuman NRG1 Protein (His Tag, ECD)Canine NRG1-alpha Protein (ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinMouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human HBEGF / DTR ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human EGF / Epidermal Growth Factor ProteinHuman Epiregulin / EREG Protein (Fc Tag) Human EGFL6 / EGF-L6 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman BTC / Betacellulin Protein (Fc Tag)Human BTC / Betacellulin ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinMouse EGF / Epidermal Growth Factor ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat EGFR / HER1 / ErbB1 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)
Background

ErbB3, also known as Her3(human epidermal growth factor receptor3), is a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound glycoprotein has a neuregulin binding domain but has not an active kinase domain., and therefore can not mediate the intracellular signal transduction through protein phosphorylation. However, its heterodimer with ErbB2 or other EGFR members responsible for tyrosine phosphorylation forms a receptor complex with high affinity, and initiates the related pathway which lead to cell proliferation or differentiation. ErbB3 has been shown to implicated in numerous cancers, including prostate, bladder, and breast tumors. This protein has different isoforms derived from alternative splicing variants, and among which, the secreted isoform lacking the intermembrane region modulates the activity of membrane-bound form.

Size / Price
Catalog:TG65001-NF
List Price: $445.00  (Save $0.00)
Price:$445.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"