After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse S100A16 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse S100A16 cDNA Clone Product Information
Gene_bank_ref_id:NM_026416.2
RefSeq ORF Size:375bp
cDNA Description:Full length Clone DNA of Mus musculus S100 calcium binding protein A16 with N terminal Myc tag.
Gene Synonym:S100F; DT1P1A7; AI325039; AI663996; 2300002L21Rik
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

S100A16 is a member of S100 protein super family that carries calcium-binding EF-hand motifs. S100 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S100A16 expression was found to be astrocyte-specific. The S100A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S100A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S100A16 was also calculated in the calcium(II)-bound form. Differently from most S100 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S100A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S100A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S100A16 protein is a novel adipogenesis-promoting factor.

References
  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
  • Size / Price
    Catalog: MG51916-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"