Quick Order

Mouse MANF Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MANFcDNA Clone Product Information
Gene_bank_ref_id:NM_029103.3
cDNA Size:540
cDNA Description:ORF Clone of Mus musculus mesencephalic astrocyte-derived neurotrophic factor DNA.
Gene Synonym:Armet, D17914, AA407711, AA408789, AA673178, D18Mgi17, 3230402M22Rik, Manf
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Neurotrophin & Receptor Related Products
Background

Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF and ARMET, is a secreted protein which belongs to the ARMET family. ARMET selectively promotes the survival of dopaminergic neurons of the ventral mid-brain. It modulates GABAergic transmission to the dopaminergic neurons of the substantia nigra. ARMET enhances spontaneous, as well as evoked, GABAergic inhibitory postsynaptic currents in dopaminergic neurons. ARMET inhibits cell proliferation and endoplasmic reticulum (ER) stress-induced cell death. The N-terminal region of ARMET may be responsible for neurotrophic activity while the C-terminal region may play a role in the ER stress response. MANF reduces endoplasmic reticulum (ER) stress and has neurotrophic effects on dopaminergic neurons. Intracortical delivery of recombinant MANF protein protects tissue from ischemic brain injury. MANF has been described as a survival factor for dopaminergic neurons. MANF expression was widespread in the nervous system and non-neuronal tissues. In the brain, relatively high MANF levels were detected in the cerebral cortex, hippocampus and cerebellar Purkinje cells. The widespread expression of MANF together with its evolutionary conserved nature and regulation by brain insults suggest that it has important functions both under normal and pathological conditions in many tissue types.

References
  • Shridhar V., et al., 1996, Oncogene 12:1931-1939.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Petrova P., et al., 2003, J. Mol. Neurosci. 20:173-188.
  • Lindholm, P. et al., 2008, Mol Cell Neurosci. 39 (3):356-71.
  • Airavaara, M. et al., 2010, Exp Neurol. 225 (1):104-13.
  • Size / Price
    Catalog:MG50954-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"