After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CRABP1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CRABP1 cDNA Clone Product Information
Gene_bank_ref_id:BC022069
RefSeq ORF Size:414bp
cDNA Description:Full length Clone DNA of Homo sapiens cellular retinoic acid binding protein 1 with N terminal HA tag.
Gene Synonym:RBP5, CRABP, CRABPI, CRABP-I
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CRABP1 is a specific binding protein for a vitamin A family member. It is thought that CRABP1 plays an important role in retinoic acid-mediated differentiation and proliferation processes. CRABP1 is structurally similar to the cellular retinol-binding proteins, but binds only retinoic acid at specific sites within the nucleus, which may contribute to vitamin A-directed differentiation in epithelial tissue. It forms a beta-barrel structure which accommodates hydrophobic ligands in its interior.

References
  • Wu Q. et al., 2007, Mol Cancer. 6: 45.
  • Tanaka K. et al., 2007, Oncogene. 26 (44): 6456-68.
  • Lind GE. et al., 2007, Cell Oncol. 28 (5-6): 259-72.
  • Size / Price
    Catalog: HG14511-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"