After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FAM3D Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FAM3DcDNA Clone Product Information
Gene_bank_ref_id:NM_146050.2
cDNA Size:672
cDNA Description:ORF Clone of Mus musculus oncoprotein induced transcript 1 DNA.
Gene Synonym:EF-7, Fam3d, AV067083, MGC37550, 2310076N21Rik, Oit1
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Family with sequence similarity 3 (FAM3) family is a novel cytokine-like gene family, which has four genes in this family, FAM3A, FAM3B, FAM3C, and FAM3D, each encoding a protein (224-235 amino acids) with a hydrophobic leader sequence. It had indicated that FAM3B/PANDER (pancreatic derived factor) is highly expressed in pancreas, and FAM3A and FAM3C in almost all tissues. FAM3D is abundantly expressed in placenta and weakly expressed in small intestine. Immunohistochemistry showed that FAM3A is expressed prominently in the vascular endothelium, particularly capillaries. FAM3A and FAM3B protein were both localized to the islets of Langerhans of the endocrine pancreas. Recombinant FAM3B protein has delayed effects on beta-cell function. FAM3C is involved in retinal laminar formation processes in vertebrates. NFATC2, SCP2, CACNA1C, TCRA, POLE, and FAM3D, were associated with narcolepsy. Some of these associations were further supported by gene expression analyses and an association study in essential hypersomnia (EHS), CNS hypersonia similar to narcolepsy.

References
  • Zhu Y, et al. (2002) Cloning, expression, and initial characterization of a novel cytokine-like gene family. Genomics. 80(2): 144-50.
  • Katahira T, et al. (2010) Secreted factor FAM3C (ILEI) is involved in retinal laminar formation. Biochem Biophys Res Commun. 392(3): 301-6.
  • Shimada M, et al. (2010) An approach based on a genome-wide association study reveals candidate loci for narcolepsy. Hum Genet. 128(4): 433-41.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"