After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CTSC / DPPI Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTSCcDNA Clone Product Information
cDNA Size:1389
cDNA Description:ORF Clone of Mus musculus cathepsin C DNA.
Gene Synonym:DPP1, DPPI, AI047818
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Cathepsins are proteases found in many types of cells conserved in all animals, which have a vital role in mammalian cellular turnover such as bone resorption. The lysosomal cysteine protease Cathepsin C (CTSC), also known as dipeptidyl peptidase I (DPPI/DPP1), activates a number of granule-associated serine proteases with pro-inflammatory and immune functions by removal of their inhibitory N-terminal dipeptides. This lysosomal exo-cysteine protease belonging to the peptidase C1 family. Active cathepsin C is found in lysosomes as a 200-kDa multimeric enzyme. Subunits constituting this assembly all arise from the proteolytic cleavage of a single precursor giving rise to three peptides: the propeptide, the alpha- and the beta-chains. It is a central coordinator for activation of many serine proteases in immune/inflammatory cells. Defects in the Cathepsin C have been shown to be a cause of Papillon-Lefevre disease, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. Cathepsin C plays a key role in the activation of several degradative enzymes linked to tissue destruction in inflammatory diseases. Thus, it is a therapeutic target for the treatment of a number of inflammatory and autoimmune diseases.

  • Santilman V, et al. (2002) Importance of the propeptide in the biosynthetic maturation of rat cathepsin C. Eur J Cell Biol. 81(12): 654-63.
  • Kam CM, et al. (2004) Design and evaluation of inhibitors for dipeptidyl peptidase I (Cathepsin C). Arch Biochem Biophys. 427(2): 123-34.
  • Noack B, et al. (2008) Cathepsin C gene variants in aggressive periodontitis. J Dent Res. 87(10): 958-63.
  • Laine DI, et al. (2010) Inhibitors of cathepsin C (dipeptidyl peptidase I). Expert Opin Ther Pat. 20(4): 497-506.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items