After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ASAH2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ASAH2 cDNA Clone Product Information
Gene_bank_ref_id:NM_018830.1
RefSeq ORF Size:2271bp
cDNA Description:Full length Clone DNA of Mus musculus N-acylsphingosine amidohydrolase 2 with N terminal His tag.
Gene Synonym:AI585898
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ASAH2 (N-acylsphingosine amidohydrolase 2), also known as neutral ceramidase, is a type II integral membrane protein that can be cleaved to produce a soluble secreted protein. The enzyme is abundant in the brush border membranes of the intestine, and also expressed in several tissues such as kidney, brain and liver. The primary structure of ASAH2/neutral ceramidase is highly conserved from bacteria to humans, however, there is a clear difference in the molecular architecture. The murine ASAH2 possesses ‘amucin box’, a Ser/Thr/Pro-rich domain glycosylated with O-glycans which is necessary to retain the enzyme on the plasma membrane as a type II integral protein. The major physiological function of ASAH2/neutral ceramidase is the metabolism of dietary sphingolipids, and thus plays a role in the generation of messenger molecules such as sphingosine and sphingosine 1-phosphate.

References
  • Tani M, et al. (2000) Molecular cloning of the full-length cDNA encoding mouse neutral ceramidase. A novel but highly conserved gene family of neutral/alkaline ceramidases. J Biol Chem. 275(15): 11229-34.
  • Franzen R, et al. (2002) Nitric oxide induces neutral ceramidase degradation by the ubiquitin/proteasome complex in renal mesangial cell cultures. FEBS Lett. 532(3): 441-4.
  • Kono M, et al. (2006) Neutral ceramidase encoded by the Asah2 gene is essential for the intestinal degradation of sphingolipids. J Biol Chem. 281(11): 7324-31.
  • Size / Price
    Catalog: MG50006-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"